Insecticidal Activity and Histopathological Effects of Vip3Aa Protein from Bacillus thuringiensis on Spodoptera litura

Abstract

Vegetative insecticidal proteins (Vips) are insecticidal proteins synthesized by Bacillus thuringiensis during the vegetative stage of growth. In this study, Vip3Aa protein, obtained by in vitro expression of the vip3Aa gene from B. thuringiensis WB5, displayed high insecticidal activity against Spodoptera litura aside from Spodoptera exigua and Helicoverpa armigera. Bioassay results showed that the toxicity of Vip3Aa protein against S. litura larvae statistically decreased along with the increase of the age of the larvae, with LC₅₀ = 2.609 ng/cm² for neonatal larvae, LC₅₀ = 28.778 ng/cm² for first instar larvae, LC₅₀ = 70.460 ng/cm² for second instar larvae, and LC₅₀ = 200.627 ng/cm² for third instar larvae. The accumulative mortality of 100% larvae appeared at 72 h for all instars of S. litura larvae, when feeding respectively with 83.22, 213.04, 341.40, and 613.20 ng/cm² of Vip3Aa toxin to the neonatal and first to third instar larvae. The histopathological effects of Vip3Aa toxin on the midgut epithelial cells of S. litura larvae was also investigated. The TEM observations showed wide damage of the epithelial cell in the midgut of S. litura larvae fed with Vip3Aa toxin.

Introduction

Bacillus thuringiensis is a gram-positive bacterium with wide insecticidal activity against numerous organisms such as mites, nematodes, protozoans, and insects of the orders Diptera, Coleoptera, Homoptera, Lepidoptera, Hymenoptera, Ortoptera, and Phthiraptera [36]. The Cry proteins or delta-endotoxins produced by this bacterium are the most well-known insecticidal proteins and have been extensively used for biocontrol of pests [22]. Besides Cry proteins, other virulence factors of this bacterium are β-exotoxin, Cyt, secreted insecticidal protein, and vegetative insecticidal proteins (Vips) [32]. Vips, synthesized during the vegetative stage of growth by several strains of B. thuringiensis, contribute to the insecticidal activity of this bacterium against insects [16,44] and share no sequence homology with Cry proteins [14]. Relative to the narrow-spectrum activity of many Cry proteins [34], Vips have a broad range of activity spectra [32].

Since the first vip gene was reported [17], a considerable number of new vip genes had been screened [3,6,23,28,30,31,35,42]. So far, more than 100 Vips have been recognized and classified into four groups, Vip1, Vip2, Vip3, and Vip4, based on the amino acid sequence similarity (http://www.lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/vip.html). Vip1 and Vip2 proteins combine to form a binary toxin and display high insecticidal activity against some coleopteran [40] and homopteran insects [35], whereas Vip3 proteins are active against a wide variety of lepidopteran insects [23,42]. Some studies indicated that Vip3 proteins display toxicity against many lepidopteran pests: Mamestra brassicae, Spodoptera littoralis, Lobesia botrana [30,33], Spodoptera frugiperda [19,38], Tuta absoluta [37], Trichoplusia ni [18], Dendrolimus pini, Cydia pomonella [7], Manduca sexta [25], Plutella xylostella [11,21,30], Ectomyelois ceratoniae [12], Ephestia kuehniella [3], Helicoverpa armigera [15,18,25,26], Heliothis virescens [17,21], and Spodoptera exigua [15,17]. However, differences in toxicity among Vip3 proteins had been found. The insecticidal activity of Vip3Aa59 is significantly higher than Vip3Aa58 towards D. pini [7]. Vip3Aa, Vip3Ae, Vip3Af, and Vip3Ab are active against most of the tested insects, whereas Vip3Ad shows no toxicity [33]. For Agrotis ipsilon, Vip3Aa1, Vip3Aa2, Vip3Ab, and Vip3Ae display insecticidal activity [33], but Vip3Aa9 and Vip3Ad are the opposite [22]. In addition, some lepidopteran insects, such as Bombyx mori [18], Danaus plexippus [25], Ostrinia nubilalis [17,25,41], and Pieris brassicae [11], are not susceptible to Vip3 proteins.

So far, little is known about the mode of action of Vip3 proteins. It is usually accepted that, as with Cry proteins, Vip3 proteins need to be solubilized in the insect gut by proteolysis and then bound to specific receptors in the brush border epithelial midgut cells, which leads to pore formation and cell lyses [24,25,27]. Several studies have shown that the target receptors in the insect midgut of Vip proteins are different from Cry proteins [9,20,27,38], which suggests the potential for using Vip proteins to complement or substitute Cry proteins on species with low susceptibility or resistance to the latter. A Vip-Cry fusion protein can be another way to expand the insecticidal spectrum of B. thuringiensis toxins [4].

Spodoptera litura is a highly dispersive and polyphagous species [43] that is known to be a serious pest of many economically valuable crops, such as cotton, chili, taro, tobacco, groundnut, tea, cabbage, eggplant, cauliflower, capsicum, potato, and castor [5,8,39], and is also notorious as one of the most destructive pests of agricultural crops in China. In order to know the potential of Vip3 proteins for use in the control of S. litura, we obtained a Vip3Aa protein by cloning and expression from B. thuringiensis WB5, assayed its insecticidal activity against S. litura, and investigated the histopathological change in the midgut of S. litura caused by this toxin. This study will contribute to the application of Vip3Aa protein for biocontrol of S. litura.

 

Materials and Methods

Insects

S. litura, S. exigua, and H. armigera were purchased from Ke Yun Biology Co. (China) and reared in a growth chamber under controlled conditions of temperature at 27 ±2 ℃, relative humidity of 55 ± 5%, and photoperiod of 16: 8 h (light/dark).

Preparation and Purification of Vip3Aa Protein

The entire coding region of the vip3Aa gene (GenBank Accession No. AF500478) of B. thuringiensis WB5 was amplified by PCR with High Fidelity Phusion DNA polymerase, using genomic DNA as template and Vip3A-F/Vip3A-R (5’GACATATGAACAAGAATAATACTAAATTAAGCAC3’/5’AGTCTAGATTACTTAATAGAGACATCGTAAAAATG3’) as primers. The PCR product was purified, cloned into the pMD18-T vector (Takara), and confirmed by sequencing.

For in vitro gene expression, the vip3Aa gene was inserted into multiple cloning sites of the pCzn1 expression vector (Zoonbio Biotechnology) and then transformed into E. coli BL21. The transformants were grown at 37℃ overnight in LB medium supplemented with ampicillin (100 μg/ml) in an orbital shaker at 220 rpm. These precultures were used as seed and transferred to 1,000 ml of the same culture medium and incubated in the same condition. When the OD600 of the cultures had reached about 0.6, Vip3Aa expression was induced with 0.2 mM isopropyl-D-thiogalactopyranoside at 16℃ for 4 h. After centrifugation at 1,200 ×g for 10 min at 4℃, the pellet was resuspended in Ni-IDA Binding-Buffer and sonicated (on ice, for 20 min, with a 5 sec pause in between, at 400 W). The suspension was centrifuged at 1,200 ×g for 10 min at 4℃, and the supernatant was collected and purified by Ni-IDA-Sepharose affinity column. The Vip3Aa protein eluted from the Ni-column was dialyzed with 0.01 mol/l PBS buffer (NaCl 8.0 g/l, KCl 0.2 g/l, Na2HPO4 1.44 g/l, KH2PO4 0.24 g/l, pH 7.2) to remove imidazole. The concentrations of Vip3Aa protein were estimated using the Bradford method [13].

Bioassays

First instar larvae of three destructive pests (S. litura, S. exigua, and H. armigera) of agricultural crops in China were used for testing their susceptibilities to Vip3Aa toxin. The larvae were fed with three concentrations (1,200, 120, and 12 ng/cm2) of Vip3Aa toxin and 0.01 mol/l PBS buffer (as control) in artificial solid diet, respectively. Thirty larvae were used for each treatment. The bioassays were performed in a growth chamber at 27 ±2 ℃, 55 ±5 % (RH), and 16:8 h (light:dark) for 8 days, with the corresponding diet replaced every 24 h. Mortality due to each treatment was recorded every 24 h for 8 days.

The toxicity of Vip3Aa toxin to the neonate and first to third instar larvae of S. litura, which is sensitive to Vip3Aa toxin, were further assayed. Various concentrations of Vip3Aa toxin were prepared by dilution with 0.01 mol/l PBS buffer, with 5-fold serial dilution for the neonate larvae and 2.5-fold for the first to third instar larvae. The different instar larvae were fed with various concentrations of Vip3Aa toxin in artificial solid diet, respectively. For each instar and each concentration, 10 larvae of S. litura were used. Treatments were duplicated and repeated six times. The environmental conditions and negative control for the bioassay were the same as those used in the susceptibility bioassay. Mortality from each treatment was recorded every 24 h for 8 days. Probit analysis of mortality data after the toxin treatment for 72 h, to estimate median lethal concentrations (LC50), 90% lethal concentrations (LC90), and 95% confidence interval (CI), was carried out with DPS software.

Sample Preparation for Histopathology Observation

Third instar S. litura larvae were starved for 2 h, and then fed with LC50 of Vip3Aa toxin and 0.01 mol/l PBS buffer (as control) in artificial diet for 24 h. After chilled on ice for 30 min, the guts were excised and fixed in 2.5% glutaraldehyde and then 1% osmic acid stationary liquid. Tissues were dehydrated via increasing ethanol concentrations, and then rinsed in 100% acetone and fixed by embedding and curing. Images were captured by transmission electron microscopy (JEM-2010 (HR)).

 

Results

Purification of Vip3Aa Protein

The gene that encodes Vip3Aa protein was cloned from B. thuringiensis WB5 and in vitro expressed in E. coli BL21. The Vip3Aa protein was obtained after the expressed products were purified by affinity chromatography with an Ni-column. Analysis by 12% SDS–PAGE showed that the molecular mass of Vip3Aa protein was about 88 kDa (Fig. 1). The Vip3Aa protein was dissolved with 0.01 mol/l PBS buffer and stored at -20℃ for use in bioassays and histopathological observations.

Fig. 1.SDS-PAGE analysis of purification Vip3Aa protein. Lane M, protein marker; Lane 1, Vip3Aa protein.

Qualitative Screening of Insect Susceptibility to Vip3Aa Protein

To investigate whether the obtained Vip3Aa is toxic to S. litura, S. exigua, and H. armigera, an initial qualitative screening was carried out. The data showed that S. litura larvae were the most sensitive to Vip3Aa toxin, followed by S. exigua. Vip3Aa protein at a low concentration (12 ng/cm2) could cause mortality of 40% to S. litura, and 100% mortality at 120 ng/cm2. Compared with S. litura, Vip3Aa protein at a higher concentration could cause similar mortality to S. exigua. H. armigera larvae were insensitive to Vip3Aa toxin, with a mortality of only 16.7% caused by the highest concentration (1200 ng/cm2) of this protein (Fig. 2).

Fig. 2.Qualitative screening of insect susceptibility to Vip3Aa toxin.

Toxicity of Vip3Aa Protein against S. litura Larvae

On the basis of the above susceptibility assay, we further tested the toxicity of Vip3Aa toxin to the neonate and first to third instar larvae of S. litura. After been fed Vip3Aa toxin, the lower instar larvae were more sensitive to the toxin. For neonatal larvae, death could be observed at 24 h after feeding with 3.33 ng/cm2 of Vip3Aa toxin. Even if the first, second, and third instar larvae were fed with 213.04, 341.40 and 1,533.00 ng/cm2 of Vip3Aa toxin, respectively, no death was observed at 24 h. The accumulative mortality of 100% larvae appeared at 72 h for all instars of larvae, when feeding 83.22, 213.04, 341.40, and 613.20 ng/cm2 of Vip3Aa toxin to the neonatal larvae, first instar larvae, second instar larvae, and third instar larvae, respectively (Fig. 3). These results revealed that the toxicity of Vip3Aa protein against S. litura larvae statistically decreased along with the increase of the age of the larvae, which corresponds to an increase of LC50 observed from low to high instar larvae, with LC50 = 2.609 ng/cm2 for neonatal larvae, LC50 = 28.778 ng/cm2 for first instar larvae, LC50 = 70.460 ng/cm2 for second instar larvae, and LC50 = 200.627 ng/cm2 for third instar larvae (Table 1).

Fig. 3.Accumulative mortality of S. litura larvae of different instars after treatment with Vip3Aa toxin. The neonate and first to third instar larvae of S. litura were fed with different concentrations (ng/cm2) of Vip3Aa toxin and 0.01 mol/l PBS buffer (as control, CK) in artificial solid diet.

Table 1.*LC50, LC90, and fiducial limit (95%) values are given in ng of toxin per cm2 of diet surface. a(CI min.–max.): confidence interval (CI 95%); bb ± (SEM): angular coefficient and standard error, parameters of the nonlinear equation for calculation; cData were significant when p < 0.05; a,b,cDPS, Data Processing System software was used for the procedures of modeling conducting. These data were calculated automatically by this software.

Histopathological Effects of Vip3Aa Protein on S. litura Larvae

The bioassay showed that Vip3Aa protein was toxic to S. litura larvae. The histopathological effects of Vip3Aa toxin on the midgut epithelial cells of S. litura larvae were detected. The observations of the midgut cross-sections showed wide damage of the midgut epithelial cells of S. litura larvae caused by Vip3Aa toxin (Fig. 4B), compared with the control (Fig. 4A). In the midgut of S. litura larvae fed with Vip3Aa toxin, the histopathological modifications included vacuolization of the cytoplasm, cellular swelling, and brush border membrane destruction (Fig. 4B-Am), the karyotheca of the cell nucleus crinkled and the chromatins dispersedly distributed (Fig. 4B-N), and mitochondria swelling and deformation with disintegration and lysis of cristae (Fig. 4B-Mi). In contrast, the midgut of S. litura larvae fed with PBS showed a well-preserved layer of epithelial cells with unaffected apical microvilli membrane (Fig. 4A-Am), a smooth karyotheca of the cell nucleus with homogeneous chromatins (Fig. 4A-N), and elliptical mitochondria with apparent cristae (Fig. 4A-Mi).

Fig. 4.Histopathological effects of Vip3Aa toxin on S. litura larvae midgut. Panel A indicates the ultrastructure of the midgut of larvae fed with PBS buffer. Panel B indicates the ultrastructure of the midgut of larvae fed with Vip3Aa toxin. Me: midgut epithelium; Bm: basement membrane; L: lumen; Am: apical membrane; N: nucleus; Mi: mitochondria.

 

Discussion

It is accepted that lepidopteran insects appear to be one of the biggest groups of crop pests [29]. Among them, Spodoptera larvae are polyphagous pests, damaging a variety of commercially important crops around the world. The three species analyzed in this study are common pests of lepidopteran, which cause extreme losses to many crops in China. B. thuringiensis Vip3 proteins exhibit strong features for controlling a wide variety of lepidopteran species. In this study, we investigated the toxicities of Vip3Aa protein, obtained by in vitro expression of the vip3Aa gene from B. thuringiensis WB5, against different instar larvae of S. litura (Table 1). The results showed that the toxicity of Vip3Aa toxin against S. litura larva statistically decreased with increases in the age of the larvae. The LC50 value of the toxin for neonatal larvae of S. litura was 2.6 ng/cm2 (Table 1), which is lower than that for S. frugiperda (LC50 = 24.66 ng/cm2), S. albula (LC50 = 3.90 ng/cm2), S. eridania (LC50 = 2.78 ng/cm2), and S. cosmioides (LC50 = 3.44 ng/cm2) [10], and S. littoralis (LC50 = 305 ng/cm2) [2], S. exigua (LC50 = 290 ng/cm2), [14] and Ephestia kuehniella (LC50 = 36 ng/cm2) [1]. In addition, we observed depressed growth of larvae that survived being fed the toxin. It can therefore be deduced that the Vip3Aa toxin is effective for controlling the population growth of S. litura.

Although little is known until now about the mode of action of Vip3 proteins, it is commonly accepted that they need to be solubilized in the insect gut to an active toxin and then bound to specific receptors in the brush border epithelial midgut cells. The histopathological effects of Vip3Aa toxin on the midgut epithelial cells of S. litura larvae were also investigated in this study. The TEM observations (Fig. 4B) showed wide damage of the epithelial cells in the midgut of S. litura larvae fed with Vip3Aa toxin. This may explain the mechanism of the insecticidal activity to a certain extent. However, the gut proteins interacting with Vip3Aa toxin remain to be identified. Future studies to identify potential Vip3Aa receptors in the midgut of S. litura based on toxin-receptor interactions are warranted, as they will be critical for clarifying the mode of action of Vip3 toxins.